BBa_K1727007 1 BBa_K1727007 T5+Lac Operator+RBS+signal peptide+Epinecidin-1+Terminater 2015-09-04T11:00:00Z 2016-02-01T01:24:01Z Epicidni Antimicrobial peptides (AMPs) are stable peptides that have extensive ability to kill or inhibit the growth of bacteria. They play a role in defense mechanism for all organisms, ranging from prokaryotes to humans, to against predators. Some of them act against specific strain of microbes. Epinecidin-1 is a kind of antimicrobial peptide. This AMP is extracted from the skin mucus of Epinephelus coioides, respectively. Epinecidin-1 has been shown to help wound healing.We treat a signal peptide in front of Epinecidin-1. This signal peptide comes from S.lividas and has ability to let E.coli secrect signiferin to LB culture medium. We use promoter,Lac operator,RBS,terminator on pQE 60 vector. false false _2148_ 4206 25489 9 false No false Ying Kuan annotation2454893 1 Lac operator range2454893 1 53 69 annotation2454874 1 T5 promoter range2454874 1 1 45 annotation2454877 1 -10 range2454877 1 39 45 annotation2454876 1 Lac operator range2454876 1 21 37 annotation2457046 1 Epinecidin-1 range2457046 1 211 414 annotation2456167 1 Signal peptide range2456167 1 118 207 annotation2457052 1 Alanine cutting site range2457052 1 208 210 annotation2459612 1 lambda t0 terminator range2459612 1 461 555 annotation2455826 1 RBS range2455826 1 92 97 annotation2456165 1 Restriction enzyme BamH I site range2456165 1 112 117 annotation2456858 1 Restriction enzyme Bgl II site range2456858 1 415 420 annotation2454875 1 -35 range2454875 1 16 21 BBa_K1727007_sequence 1 tcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaatttcacacagaattcattaaagaggagaaattaaccatgggaggatccatgggctttcgtcataaagcggcggcgctggcggcgaccctggcgctgccgctggcgggcctggtgggcctggcgagcccggcgcaggcggcgatgaggtgcatcgccctctttcttgtgttgtcgctggtggtcctcatggctgaacccggggagggttttatcttccacatcattaaaggactctttcacgctggcaagatgatccatggacttgtcaccaggagacgacatggcgtggaagagctgcaagacctggaccaacgtgcctttgaacgagagaaagcttttgcctgaagatctcatcaccatcaccatcactaagcttaattagctgagcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z