BBa_K1727008 1 BBa_K1727008 T5+Lac Operator+RBS+Signal peptide+Signiferin+Terminater 2015-09-04T11:00:00Z 2016-02-03T10:43:43Z EPi Antimicrobial peptides (AMPs) are stable peptides that have extensive ability to kill or inhibit the growth of bacteria. They play a role in defense mechanism for all organisms, ranging from prokaryotes to humans, to against predators. Some of them act against specific strain of microbes. Signiferin is a kinds of antimicrobial peptide extracted from the skin mucus of Crinia signifera, respectively. It demonstrated effectiveness in killing MRSA. And we had change it's sequence into E.coli codon usage. We treat a signal peptide in front of signiferin. This signal peptide comes from S.lividas and has ability to let E.coli secrect signiferin to LB culture medium. We used promoter,Lac operator,RBS,terminator on pQE60 to made our expression machine worked. false false _2148_ 4206 25489 9 false No false Ying Kuan annotation2460025 1 3X stop codon range2460025 1 244 252 annotation2444152 1 RBS range2444152 1 92 97 annotation2459984 1 Signal peptide range2459984 1 106 195 annotation2460185 1 lambda t0 terminator range2460185 1 305 399 annotation2444149 1 -35 range2444149 1 16 21 annotation2444150 1 -10 range2444150 1 39 45 annotation2460073 1 Restriction enzyme BamH I site range2460073 1 253 258 annotation2444151 1 Lac operator range2444151 1 53 69 annotation2444153 1 Lac operator range2444153 1 21 37 annotation2459629 1 Restriction enzyme Nco I site range2459629 1 104 109 annotation2444148 1 T5 promoter range2444148 1 1 45 annotation2460008 1 Alanine cutting site range2460008 1 196 198 annotation2460009 1 Signiferin range2460009 1 199 243 BBa_K1727008_sequence 1 tcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaatttcacacagaattcattaaagaggagaaattaaccatgggctttcgtcataaagcggcggcgctggcggcgaccctggcgctgccgctggcgggcctggtgggcctggcgagcccggcgcaggcggcgattattggccatctgattaaaaccgcgctgggcatgctgggcctgtaataataaggatccagatctcatcaccatcaccatcactaagcttaattagctgagcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z