BBa_K1728000 1 BBa_K1728000 IL8 toehold switch RNA sensor 2015-09-15T11:00:00Z 2015-09-16T11:02:34Z Order the DNA part from synthesis company. IL8 toehold switch RNA sensor false false _2149_ 18379 18379 9 true No false Yung-Li Chen, Timothy Chan En Haw annotation2463767 1 RBS range2463767 1 39 46 annotation2463788 1 Start Codon range2463788 1 55 57 BBa_K1728000_sequence 1 tagatgaagttgtgaagtacataacacaccatacagaaacagaggagatatccaatgaatacatgaaacctggcggcagcgcaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z