BBa_K1728000 1 BBa_K1728000 IL8 toehold switch RNA sensor 2015-09-15T11:00:00Z 2015-09-16T11:02:34Z Order the DNA part from synthesis company. IL8 toehold switch RNA sensor false false _2149_ 18379 18379 9 true No false Yung-Li Chen, Timothy Chan En Haw annotation2463767 1 RBS range2463767 1 39 46 annotation2463788 1 Start Codon range2463788 1 55 57 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_K1728008 1 BBa_K1728008 IL8 toehold switch RNA sensor with T7 promoter 2015-09-16T11:00:00Z 2015-09-16T11:56:41Z Order the DNA part from synthesis company IL8 toehold switch RNA sensor with T7 promoter false false _2149_ 18379 18379 9 false No, false Yung-Li Chen, Timothy Chan En Haw component2464083 1 BBa_K1728000 component2464080 1 BBa_I719005 annotation2464083 1 BBa_K1728000 range2464083 1 24 108 annotation2464080 1 BBa_I719005 range2464080 1 1 23 BBa_K1728008_sequence 1 taatacgactcactatagggagatagatgaagttgtgaagtacataacacaccatacagaaacagaggagatatccaatgaatacatgaaacctggcggcagcgcaaa BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_K1728000_sequence 1 tagatgaagttgtgaagtacataacacaccatacagaaacagaggagatatccaatgaatacatgaaacctggcggcagcgcaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z