BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_K1728002 1 BBa_K1728002 DUSP1 toehold switch RNA sensor 2015-09-15T11:00:00Z 2015-09-16T11:08:41Z Order the DNA part from synthesis company. DUSP1 toehold switch RNA sensor false false _2149_ 18379 18379 9 false No. false Yung-Li Chen, Timothy Chan En Haw annotation2463814 1 RBS range2463814 1 39 46 annotation2463817 1 Start Codon range2463817 1 55 57 BBa_K1728010 1 BBa_K1728010 DUSP1 toehold switch RNA sensor with T7 promoter 2015-09-16T11:00:00Z 2015-09-17T12:09:33Z Order the DNA part from synthesis company DUSP1 toehold switch RNA sensor with T7 promoter false false _2149_ 18379 18379 9 false No false Yung-Li Chen, Timothy Chan En Haw component2464186 1 BBa_K1728002 component2464183 1 BBa_I719005 annotation2464183 1 BBa_I719005 range2464183 1 1 23 annotation2464186 1 BBa_K1728002 range2464186 1 24 108 BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_K1728010_sequence 1 taatacgactcactatagggagaaaataaattgaagtgggctcaaggagacccatacagaaacagaggagatatcccatgggaactcggaacctggcggcagcgcaaa BBa_K1728002_sequence 1 aaataaattgaagtgggctcaaggagacccatacagaaacagaggagatatcccatgggaactcggaacctggcggcagcgcaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z