BBa_R0085 1 BBa_R0085 T7 Consensus Promoter Sequence 2005-02-21T12:00:00Z 2015-05-08T01:14:15Z Sequence obtained from Sri Kosuri Released HQ 2013 The T7 promoter should only produce PoPS when the T7 polymerase is also being expressed. false false _11_6_ 0 135 7 In stock false false Barry Canton annotation1721522 1 Initiation Region range1721522 1 12 23 annotation1721521 1 Polymerase Binding Region range1721521 1 1 11 annotation1721520 1 Transcription Start Site range1721520 1 18 18 BBa_K1728013 1 BBa_K1728013 IL1β partial sequence with T7 promoter 2015-09-16T11:00:00Z 2015-09-17T12:25:51Z IL1β partial sequence (order from synthesis company) assembled with T7 promoter (BBa_R0085) at the downstream IL1β partial sequence with T7 promoter false false _2149_ 18379 18379 9 false No false Yung-Li Chen, Hsin-Yin Chang, Timothy Chan En Haw component2464241 1 BBa_R0085 component2464242 1 BBa_K1728005 annotation2464241 1 BBa_R0085 range2464241 1 1 23 annotation2464242 1 BBa_K1728005 range2464242 1 32 120 BBa_K1728005 1 BBa_K1728005 IL1β partial sequence 2015-09-16T11:00:00Z 2015-09-16T11:38:47Z Order the DNA part from synthesis company. IL1β partial sequence false false _2149_ 18379 18379 9 false No false Yung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu BBa_K1728005_sequence 1 ccttccaggagaatgacctgagcaccttctttcccttcatctttgaagaagaacctatcttcttcgacacatgggataacgaggcttat BBa_R0085_sequence 1 taatacgactcactatagggaga BBa_K1728013_sequence 1 taatacgactcactatagggagatactagagccttccaggagaatgacctgagcaccttctttcccttcatctttgaagaagaacctatcttcttcgacacatgggataacgaggcttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z