BBa_K1728014 1 BBa_K1728014 DUSP1 partial sequence with T7 promoter 2015-09-16T11:00:00Z 2015-09-17T12:31:08Z DUSP1 partial sequence (order from synthesis company) assembled with T7 promoter (BBa_R0085) at the downstream DUSP1 partial sequence with T7 promoter false false _2149_ 18379 18379 9 false No. false Yung-Li Chen, Hsin-Yin Chang, Timothy Chan En Haw component2464246 1 BBa_R0085 component2464247 1 BBa_K1728006 annotation2464247 1 BBa_K1728006 range2464247 1 32 133 annotation2464246 1 BBa_R0085 range2464246 1 1 23 BBa_R0085 1 BBa_R0085 T7 Consensus Promoter Sequence 2005-02-21T12:00:00Z 2015-05-08T01:14:15Z Sequence obtained from Sri Kosuri Released HQ 2013 The T7 promoter should only produce PoPS when the T7 polymerase is also being expressed. false false _11_6_ 0 135 7 In stock false false Barry Canton annotation1721520 1 Transcription Start Site range1721520 1 18 18 annotation1721521 1 Polymerase Binding Region range1721521 1 1 11 annotation1721522 1 Initiation Region range1721522 1 12 23 BBa_K1728006 1 BBa_K1728006 DUSP1 partial sequence 2015-09-16T11:00:00Z 2015-09-16T11:42:04Z Order the DNA part from synthesis company. DUSP1 partial sequence false false _2149_ 18379 18379 9 false No false Yung-Li Chen, Pei-yi Wu, Cheng-Hsiung Hsu BBa_K1728006_sequence 1 tgggaggggctcgagagggctggtccttatttatttaacttcacccgagttcctctgggtttctaagcagttatggtgatgacttagcgtcaagacatttgc BBa_K1728014_sequence 1 taatacgactcactatagggagatactagagtgggaggggctcgagagggctggtccttatttatttaacttcacccgagttcctctgggtttctaagcagttatggtgatgacttagcgtcaagacatttgc BBa_R0085_sequence 1 taatacgactcactatagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z