BBa_K1728020 1 BBa_K1728020 Rhodopsin signaling peptide (bovine) 2015-09-16T11:00:00Z 2015-09-17T01:15:44Z Order the DNA part from synthesis company rhodopsin signaling peptide (bovine) false false _2149_ 18379 18379 9 false No false Wan-Yun Chiu, Ming-Fei Hsieh BBa_K1728020_sequence 1 atgaatggtacagaaggacctaatttctatgttccattctcaaataagaccggtgttgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z