BBa_K1728022 1 BBa_K1728022 LUCY tag 2015-09-16T11:00:00Z 2015-09-17T01:32:36Z Order the DNA part from synthesis company LUCY tag false false _2149_ 18379 18379 9 false No false Wan-Yun Chiu BBa_K1728022_sequence 1 atgagaccacaaattctattactattggctttgttaactttgggtttagctggttct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z