BBa_K1728022 1 BBa_K1728022 LUCY tag 2015-09-16T11:00:00Z 2015-09-17T01:32:36Z Order the DNA part from synthesis company LUCY tag false false _2149_ 18379 18379 9 false No false Wan-Yun Chiu BBa_K1728023 1 BBa_K1728023 LUCY rhodopsin signalling peptide 2015-09-16T11:00:00Z 2015-09-17T01:36:59Z Order the DNA part from synthesis company LUCY rhodopsin signalling peptide false false _2149_ 18379 18379 9 false No false Wan-Yun Chiu, Ming-Fei Hsieh component2464321 1 BBa_K1728022 component2464320 1 BBa_K1728020 annotation2464320 1 BBa_K1728020 range2464320 1 1 60 annotation2464321 1 BBa_K1728022 range2464321 1 61 117 BBa_K1728020 1 BBa_K1728020 Rhodopsin signaling peptide (bovine) 2015-09-16T11:00:00Z 2015-09-17T01:15:44Z Order the DNA part from synthesis company rhodopsin signaling peptide (bovine) false false _2149_ 18379 18379 9 false No false Wan-Yun Chiu, Ming-Fei Hsieh BBa_K1728020_sequence 1 atgaatggtacagaaggacctaatttctatgttccattctcaaataagaccggtgttgtt BBa_K1728023_sequence 1 atgaatggtacagaaggacctaatttctatgttccattctcaaataagaccggtgttgttatgagaccacaaattctattactattggctttgttaactttgggtttagctggttct BBa_K1728022_sequence 1 atgagaccacaaattctattactattggctttgttaactttgggtttagctggttct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z