BBa_K1729001 1 yeast uS12 Yeast mitochondrial ribosomal protein MRPS12 2015-09-13T11:00:00Z 2015-09-18T08:39:36Z The sequence is from the S. cerevisiae genome. The translational unit includes the Kozak and full optimized coding sequence for the Saccharomyces cerevisiae MRPS12 gene, which encodes a ribosomal protein of the small subunit of the mitochondrial ribosome. The coding sequence begins with a mitochondrial localization signal, which is presumably removed in the mitochondrion. The resultant protein is a uS12 homologue. false false _2150_ 12086 12086 9 false Since this part is designed for expression in yeast, and the Kozak sequence includes the first nucleotides of the coding sequence, it was cloned as a translational unit. false Dani Bauhan and Richard Anthony annotation2455110 1 Mt localization signal range2455110 1 19 102 annotation2455108 1 MRPS12 range2455108 1 19 480 annotation2455099 1 Kozak range2455099 1 1 22 BBa_K1729001_sequence 1 agcaggccaacaagagccatgttgtcaagattcatgtctaatacttggtgtactccattgagacaagctcaaagattgttctcttctactactactatgcaagctactttgaatcaaattaaaagaggttctggtccaccaagaagaaaaaaaatttctactgctccacaattggatcaatgtccacaaagaaaaggtgttgttttgagagttatggttttgaaaccaaaaaaaccaaattctgctcaaagaaaagcttgtagagttagattgactaatggtaatgttgtttctgcttatattccaggtgaaggtcatgatgctcaagaacattctattgtttatgttagaggtggtagatgtcaagatttgccaggtgttaaatatcatgttattagaggtgctggtgatttgtctggtgttgttaatagaatttcttcaagatctaaatatggtgctaaaaaaccatctaaatcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z