BBa_K1729002 1 BBa_K1729002 Yeast MRPS12 mitochondrial localization signal 2015-09-13T11:00:00Z 2015-09-15T01:28:53Z Saccharomyces cerevisiae MRPS12 gene. This translational start sequence includes the Kozak and optimized coding sequence for the mitochondrial localization signal of yeast mitochondrial ribosomal protein MRPS12. false false _2150_ 12086 12086 9 false The Kozak is included since it includes the first nucleotides of the coding sequence. In addition, since this part encodes only the mitochondrial localization signal, which is removed in the mitochondrion, no stop codon is included. false Dani Bauhan and Richard Anthony annotation2455130 1 Mt localization signal range2455130 1 19 102 annotation2455129 1 Kozak range2455129 1 1 22 BBa_K1729002_sequence 1 agcaggccaacaagagccatgttgtcaagattcatgtctaatacttggtgtactccattgagacaagctcaaagattgttctcttctactactactatgcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z