BBa_K1732027 1 BBa_K1732027 GLuc-His 2015-09-17T11:00:00Z 2016-01-19T01:23:44Z BBa_K1732003 Gaussia Luciferase (BBa_K1732003) with 6X-His tag for easier protein purification. Sequence was codon optimized for E.coli via IDT codon optimization tools. false false _2154_ 4206 27195 9 Not in stock false 6X-His tag for easier protein purification. Sequence was codon optimized for E.coli via IDT codon optimization tools. false Donna Lee annotation2469631 1 6X-His range2469631 1 504 522 annotation2469630 1 GLucCO range2469630 1 1 503 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1732000 1 BBa_K1732000 J23100-PelB-GlucHCO-B0015 2015-09-02T11:00:00Z 2015-09-18T01:01:25Z Engineered from XXXXXXXX. Provided by the Bruchez lab at Carnegie Mellon. J23100 Promoter with a RBS (BBa_S04423), PelB Leader sequence, Gaussia princeps luciferase, and a B0015 terminator. Allows Gaussia princeps luciferase to be transcribed and translated using a strong promoter. Luminescence can be expressed by reacting the luciferase product with coelenterazine. false false _2154_ 27195 27195 9 false This sequence is codon optimized for E.coli. Sequence contains a PelB leader sequence that allows the Gaussia princeps luciferase proteins to secreted into the periplasmic space of the cell. false Donna Lee component2469777 1 BBa_B0034 component2469780 1 BBa_K208004 component2469775 1 BBa_J23100 component2469783 1 BBa_K1732027 component2469790 1 BBa_B0015 annotation2469775 1 BBa_J23100 range2469775 1 1 35 annotation2469790 1 BBa_B0015 range2469790 1 666 794 annotation2469780 1 BBa_K208004 range2469780 1 62 127 annotation2469777 1 BBa_B0034 range2469777 1 44 55 annotation2469783 1 BBa_K1732027 range2469783 1 136 657 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K208004 1 BBa_K208004 PelB Signal Peptide - Silver Fusion Compatible 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z Annealing Released HQ 2013 PelB false false _310_ 0 3473 9 In stock false Silver Fusion false USU iGEM 2009 annotation2062221 1 Start range2062221 1 1 3 annotation2034606 1 PelB range2034606 1 1 66 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1732000_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcctactagagaaaccgacggagaacaatgaagactttaatatcgtggcggtggcatcgaatttcgcgactaccgacctggacgcagaccggggtaaacttccgggcaaaaaacttcctttggaagtactgaaagaaatggaagcgaacgcacgtaaagccgggtgtacccgtggttgcttaatctgcctcagtcacattaagtgcacaccgaagatgaaaaagttcattcctggccggtgccatacctatgaaggtgataaagaaagtgcccagggcggcattggtgaagccattgtagacattccggaaatcccaggtttcaaagacttagaaccaatggaacagttcatcgcgcaagtggacctgtgcgtggattgcacgacgggttgtcttaaagggctggccaatgtccagtgctcagatctgctgaagaaatggctgcctcaacgctgcgctacgtttgcgagcaagattcagggccaggtggacaagattaagggtgcaggcggtgaccatcatcaccaccatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1732027_sequence 1 aaaccgacggagaacaatgaagactttaatatcgtggcggtggcatcgaatttcgcgactaccgacctggacgcagaccggggtaaacttccgggcaaaaaacttcctttggaagtactgaaagaaatggaagcgaacgcacgtaaagccgggtgtacccgtggttgcttaatctgcctcagtcacattaagtgcacaccgaagatgaaaaagttcattcctggccggtgccatacctatgaaggtgataaagaaagtgcccagggcggcattggtgaagccattgtagacattccggaaatcccaggtttcaaagacttagaaccaatggaacagttcatcgcgcaagtggacctgtgcgtggattgcacgacgggttgtcttaaagggctggccaatgtccagtgctcagatctgctgaagaaatggctgcctcaacgctgcgctacgtttgcgagcaagattcagggccaggtggacaagattaagggtgcaggcggtgaccatcatcaccaccatcac BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K208004_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcc BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z