BBa_K1732020 1 BBa_K1732020 GFP-HIS 2015-09-15T11:00:00Z 2016-01-25T01:12:20Z Unknown GFP with a 6X His tag for easier protein purification. false false _2154_ 4206 27195 9 false Codon optimized for E.coli. false Donna Lee annotation2462824 1 GFPCO range2462824 1 1 713 annotation2462825 1 6x-His range2462825 1 714 731 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1732009 1 BBa_K1732009 pSB1C3-J23100-B0034-GFP-His-B0015 2015-09-08T11:00:00Z 2015-09-16T06:37:12Z Sequence designed by Cheryl Telmer from Bruchez lab in Carnegie Mellon University. pSB1C3-J23100-B0034-GFP-His-B0015 false false _2154_ 27195 27195 9 false Sequence is codon optimized for E.coli false Donna Lee component2462858 1 BBa_B0034 component2462861 1 BBa_K1732020 component2462856 1 BBa_J23100 component2462868 1 BBa_B0015 annotation2462861 1 BBa_K1732020 range2462861 1 62 793 annotation2462856 1 BBa_J23100 range2462856 1 1 35 annotation2462868 1 BBa_B0015 range2462868 1 802 930 annotation2462858 1 BBa_B0034 range2462858 1 44 55 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1732020_sequence 1 atgcgcaaaggcgaagaactgtttaccggggttgtgccgatcctggtcgaacttgatggcgacgtaaacggccacaagtttagcgtatccggagaaggcgaaggtgatgcaacctacggaaaactgaccttgaagttcatttgtacgaccggtaaacttccggttccgtggccgaccctggtgacgacctttggttacggcgtacagtgttttgctcgttacccagatcatatgaagcagcatgatttctttaaatcggcaatgccggaaggctacgtgcaagaacgtaccattttctttaaagacgatggcaattataaaacccgcgcggaggtgaaattcgaaggagatactctggtgaatcgcatcgagctgaaggggatcgacttcaaagaggacggcaatattctggggcataaattagaatataattacaacagtcacaatgtgtacattatggcggacaaacagaagaatggcatcaaggttaactttaagatccgccacaacattgaagacggttccgttcaactggccgatcattatcagcagaatacgcccattggtgatggacctgtgctcctcccggataatcattatctgagcactcaatccgctctgagtaaggacccaaacgagaagcgtgatcatatggtattgctggaatttgttaccgcagccggcattacccacggcatggacgagttatacaagcatcatcaccaccatcac BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1732009_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgcgcaaaggcgaagaactgtttaccggggttgtgccgatcctggtcgaacttgatggcgacgtaaacggccacaagtttagcgtatccggagaaggcgaaggtgatgcaacctacggaaaactgaccttgaagttcatttgtacgaccggtaaacttccggttccgtggccgaccctggtgacgacctttggttacggcgtacagtgttttgctcgttacccagatcatatgaagcagcatgatttctttaaatcggcaatgccggaaggctacgtgcaagaacgtaccattttctttaaagacgatggcaattataaaacccgcgcggaggtgaaattcgaaggagatactctggtgaatcgcatcgagctgaaggggatcgacttcaaagaggacggcaatattctggggcataaattagaatataattacaacagtcacaatgtgtacattatggcggacaaacagaagaatggcatcaaggttaactttaagatccgccacaacattgaagacggttccgttcaactggccgatcattatcagcagaatacgcccattggtgatggacctgtgctcctcccggataatcattatctgagcactcaatccgctctgagtaaggacccaaacgagaagcgtgatcatatggtattgctggaatttgttaccgcagccggcattacccacggcatggacgagttatacaagcatcatcaccaccatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z