BBa_K1732023 1 BBa_K1732023 OFPCO-His 2015-09-17T11:00:00Z 2015-09-17T11:33:58Z BBa_K1732011 OFP (BBa_K1732011) with 6X-His for easier protein purification. Original equation was codon optimized for E.coli via IDT codon optimization tool. false false _2154_ 27195 27195 9 false His tag for easier protein purification and sequence was codon optimized for E. coli. false Donna Lee annotation2469302 1 6X-His range2469302 1 723 741 annotation2469301 1 OFPCO range2469301 1 1 722 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1732011 1 BBa_K1732011 pSB1C3-J23100-B0034-OFP-His-B0015 2015-09-08T11:00:00Z 2015-09-17T11:33:56Z Sequence designed by Cheryl Telmer from Bruchez lab in Carnegie Mellon University. pSB1C3-J23100-B0034-OFP-His-B0015 false false _2154_ 27195 27195 9 false Sequence is codon optimized for E.coli false Donna Lee component2469316 1 BBa_J23100 component2469321 1 BBa_K1732023 component2469328 1 BBa_B0015 component2469318 1 BBa_B0034 annotation2469328 1 BBa_B0015 range2469328 1 811 939 annotation2469318 1 BBa_B0034 range2469318 1 44 55 annotation2469321 1 BBa_K1732023 range2469321 1 62 802 annotation2469316 1 BBa_J23100 range2469316 1 1 35 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1732011_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatggtgagcaaaggggaagaaaacaatatggctattatcaaagaatttatgcgttttaaagtgcgtatggaagggagtgttaatggtcatgaatttgagatcgaaggtgaaggagaaggccgtccgtatgaaggatttcagactgcgaaattaaaagtcaccaaaggaggaccgttgccgtttgcttgggatattttgtccccgcagtttacatatggctcgaaagcatatgttaaacatccggcggatattcctgattattttaaattaagtttcccggaaggctttaagtgggaacgcgtgatgaattttgaagacggcggtgttgtgaccgttacccaagatagcagcttacaggacggtgaatttatctataaggttaagctgcgcggcacgaatttcccgtctgatggcccggtcatgcaaaaaaaaaccatgggatgggaagcaagcagcgagcgtatgtaccctgaagatggcgcgctgaagggtgaaatcaaaatgcgcttgaaattgaaagatggcggccattataccagtgaagtcaaaactacctacaaagctaaaaaaccggtccaactgccgggcgcatatattgtaggtatcaaactggacattacgtcccacaatgaagattatacaattgttgaacagtatgagcgtgcagaaggccgtcattctacgggtggaatggatgagttatataaaggttcgggtaccgcgcatcatcaccaccatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1732023_sequence 1 atggtgagcaaaggggaagaaaacaatatggctattatcaaagaatttatgcgttttaaagtgcgtatggaagggagtgttaatggtcatgaatttgagatcgaaggtgaaggagaaggccgtccgtatgaaggatttcagactgcgaaattaaaagtcaccaaaggaggaccgttgccgtttgcttgggatattttgtccccgcagtttacatatggctcgaaagcatatgttaaacatccggcggatattcctgattattttaaattaagtttcccggaaggctttaagtgggaacgcgtgatgaattttgaagacggcggtgttgtgaccgttacccaagatagcagcttacaggacggtgaatttatctataaggttaagctgcgcggcacgaatttcccgtctgatggcccggtcatgcaaaaaaaaaccatgggatgggaagcaagcagcgagcgtatgtaccctgaagatggcgcgctgaagggtgaaatcaaaatgcgcttgaaattgaaagatggcggccattataccagtgaagtcaaaactacctacaaagctaaaaaaccggtccaactgccgggcgcatatattgtaggtatcaaactggacattacgtcccacaatgaagattatacaattgttgaacagtatgagcgtgcagaaggccgtcattctacgggtggaatggatgagttatataaaggttcgggtaccgcgcatcatcaccaccatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z