BBa_K1733000 1 BBa_K1733000 orf7 Recombination Directionality Factor 2015-09-16T11:00:00Z 2015-09-17T03:37:13Z Porcine Reproductive and Respiratory Syndrome Virus This protein is the corresponding recombination directionality factor to the TP901-1 integrase. It catalyzes the unidirectional inverse reaction of the TP901-1 integrase. It recognizes AttL and AttR recombination sites that flank some sequence of interest, and inverts the entire sequence within the recombination sites, knocking out any genes contained in the sequence. After flipping the sequence of interest, orf7 will no longer recognize the recombination sites, so the sequence will not be flipped again. To test this part within our project, we used a reporter that contained a gene that codes for a fluorescent protein flanked by the AttL and AttR recombination sites. Originally, this fluorescent protein is unexpressed, but when the orf7 RDF catalyzes the inversion reaction, the sequence in between the recombination sites is flipped, and the fluorescent protein is expressed. false false _2155_ 26261 26261 9 false Since this protein is extremely small, it was already biobrick compatible and we were also able to test it in mammalian systems false Jeffrey Chen BBa_K1733000_sequence 1 atgggcgacaagagaagcccaacaaagacagtgacaagctggcctaatgtgaccttttggagcgagggaaagaccaatagcatgaacaaggaggagttcgaggagttcaagagcagaacagtttggcctaatggagtgggagagatgagagtgagagatgcctacaataccgtgatggagaggctgaagagctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z