BBa_K1734000 1 pPH Polyhedrin promoter (pPH) 2015-09-16T11:00:00Z 2015-09-17T09:28:48Z The promoter is derived from the baculovirus Autographa californica. Natively, this promoter activates the transcription of the polyhedrin gene (polh), a major occlusion-body matrix protein expressed during the very late phase of infection [1]. false false _2156_ 20170 20170 9 false Recommended for baculovirus expression vector system (BEVS). false Eduardo Ram??rez Montiel annotation2468228 1 Promoter range2468228 1 1 94 BBa_K1734000_sequence 1 gatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z