BBa_K1734002 1 BBa_K1734002 Polyhedrin promoter + Mellitin???s signal Peptide 2015-09-17T11:00:00Z 2015-09-17T11:31:10Z Derived from Autographa californica and Abis mellifera The biobrick contains the polyhedrin promoter from the baculovirus Autographa californica. After the promoter there is a secretion signal sequence of the protein Mellitin from the organism Abis mellifera (Honeybee) [1]. Reference: [1]Ailor, E. and Betenbaugh, M. 1999. Modifying secretion and post-translational processing in insect cells. Current Opinion in Biotechnology. 10(2): 142-145 false false _2156_ 20170 20170 9 false Recommended for baculovirus expression vector system (BEVS). false Eduardo Ram??rez Montiel annotation2469013 1 BBa_K1734000 range2469013 1 1 93 annotation2469134 1 Signal peptide range2469134 1 94 157 BBa_K1734002_sequence 1 gatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatatgaagttcctggttaacgtggctctcgtcttcatggtggtctacatctcctacatttacgcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z