BBa_K1734003 1 BBa_K1734003 Polyhedrin promoter + Lysozyme???s signal peptide 2015-09-17T11:00:00Z 2015-09-18T12:44:26Z The sequence is derived from Autographa californica and Gallus gallus The biobrick contains the polyhedrin promoter from the baculovirus Autographa californica. After the promoter there is a secretion signal sequence of the protein lysozyme from the organism Gallus gallus (chicken) [1]. false false _2156_ 20170 20170 9 false Recommended for baculovirus expression vector system (BEVS). false Eduardo Ram??rez Montiel annotation2469632 1 BBa_K1734000 range2469632 1 1 94 annotation2469634 1 signal peptide range2469634 1 95 148 BBa_K1734003_sequence 1 gatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatatgcgctccctgctcatcttggtgctgtgcttcctccctttggctgccctgggtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z