BBa_K1734006 1 BBa_K1734006 6xHis-T2A-Nanoluc 2015-09-17T11:00:00Z 2015-09-18T08:29:09Z Genetic design This part encodes a sequence capable to add a purification tag (6X His) at the 3??? terminus of a desired protein. Furthermore, by using the reporter gene (nanoluc) it???s possible to quantify indirectly the protein concentration. The T2A sequence cleaves the protein [1], producing the protein of interest tagged with HisTag and nanoluc separately This part has been codon optimized for Spodoptera frugiperda (Sf9) Reference: [1] Kim JH, Lee S-R, Li L-H, Park H-J, Park J-H, Lee KY, et al. (2011) High Cleavage Efficiency of a 2A Peptide Derived from Porcine Teschovirus-1 in Human Cell Lines, Zebrafish and Mice. PLoS ONE 6(4): e18556. doi:10.1371/journal.pone.0018556 false false _2156_ 20170 20170 9 false The sequence produces two proteins separately, the protein of interest and nanoluc false Eduardo Ram??rez Montiel annotation2470628 1 T2A sequence range2470628 1 19 74 annotation2470653 1 Nanoluc range2470653 1 75 599 annotation2470346 1 6xHis Tag range2470346 1 1 18 BBa_K1734006_sequence 1 ccaccatcaccatcaccatgagggtagaggatccctgctcacctgcggagacgtggaggaaaaccctggtcccatggctggtgtcttcacgctggaggacttcgttggagattggcgccagacagccggttacaacttggaccaggttctggaacaaggtggcgtgtccagcctcttccagaacttgggcgtttctgtgactccaatccaaaggattgtgctctcaggagaaaacggtttgaagatcgacattcacgtcatcattccgtacgagggcctgagtggagatcagatgggacaaatcgaaaagattttcaaagtggtctaccccgtggacgatcaccatttcaaagtcatcctgcattacggtactctcgtcattgacggcgttacacctaacatgatcgattacttcggacgcccctacgagggtattgcagttttcgacggcaagaaaatcaccgtcactggcacactgtggaacggaaacaagatcattgacgaaaggctcatcaaccctgatggctccctgctcttcagagtgacgatcaacggtgtcaccggatggagattgtgcgagcgtatcctggctaccggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z