BBa_K174000 1 BBa_K174000 SspB proteolysis chaperone 2009-09-25T11:00:00Z 2015-05-08T01:10:58Z 498 bp long sspB CDS is amplified by PCR with dangling end primers with EcoRI-NotI-XbaI restriction site at 5??? and SpeI at 3??? and inserted into a Biobrick compatible vector. The sequence is taken from E. coli strain DH5 alpha. Genbank accession number for E. coli MG1655 strain is NC_000913.2 SspB protein targets proteins tagged with modified degradation tag, ssrA, and deliver them to ClpXP for proteolysis. Modified ssrA tags are fused onto the 3??? end of a gene. false false _277_ 0 3942 9 It's complicated false Forward primer used: GATCTG-GAATTCGCGGCCGCTTCTAG-ATGGATTTGTCACAGCTAAC (Clamp sequence - Standard Biobrick prefix - first 20 base from the Biobrick) Reverse primer used: TGTGAC-ACTAGTA-TTACTTCACAACGCGTAATGC (Clamp sequence - SpeI site - last 21 base from the Biobrick) false The Newcastle 2009 iGEM team annotation2027215 1 sspB range2027215 1 1 498 BBa_K174000_sequence 1 atggatttgtcacagctaacaccacgtcgtccctatctgctgcgtgcattctatgagtggttgctggataaccagctcacgccgcacctggtggtggatgtgacgctccctggcgtgcaggttcctatggaatatgcgcgtgacgggcaaatcgtactcaacattgcgccgcgtgctgtcggcaatctggaactggcgaatgatgaggtgcgctttaacgcgcgctttggtggcattccgcgtcaggtttctgtgccgctggctgccgtgctggctatctacgcccgtgaaaatggcgcaggcacgatgtttgagcctgaagctgcctacgatgaagataccagcatcatgaatgatgaagaggcatcggcagacaacgaaaccgttatgtcggttattgatggcgacaagccagatcacgatgatgacactcatcctgacgatgaacctccgcagccaccacgcggtggtcgaccggcattacgcgttgtgaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z