BBa_K174000 1 BBa_K174000 SspB proteolysis chaperone 2009-09-25T11:00:00Z 2015-05-08T01:10:58Z 498 bp long sspB CDS is amplified by PCR with dangling end primers with EcoRI-NotI-XbaI restriction site at 5??? and SpeI at 3??? and inserted into a Biobrick compatible vector. The sequence is taken from E. coli strain DH5 alpha. Genbank accession number for E. coli MG1655 strain is NC_000913.2 SspB protein targets proteins tagged with modified degradation tag, ssrA, and deliver them to ClpXP for proteolysis. Modified ssrA tags are fused onto the 3??? end of a gene. false false _277_ 0 3942 9 It's complicated false Forward primer used: GATCTG-GAATTCGCGGCCGCTTCTAG-ATGGATTTGTCACAGCTAAC (Clamp sequence - Standard Biobrick prefix - first 20 base from the Biobrick) Reverse primer used: TGTGAC-ACTAGTA-TTACTTCACAACGCGTAATGC (Clamp sequence - SpeI site - last 21 base from the Biobrick) false The Newcastle 2009 iGEM team annotation2027215 1 sspB range2027215 1 1 498 BBa_K174002 1 BBa_K174002 Arabinose controlled protein degradation device 2009-09-25T11:00:00Z 2015-05-08T01:10:58Z Comprised of other Biobricks The purpose of this system is to control the expression of sspB, the degradation controller. The system is inducible by arabinose, therefore we can alter the arabinose levels to regulate the degradation of proteins with sspB degradation tag false false _277_ 0 3942 9 It's complicated true sspB Biobrick is inserted after araR promoter+rbs system false The Newcastle 2009 iGEM team component2027244 1 BBa_K174001 component2027246 1 BBa_K174000 annotation2027244 1 BBa_K174001 range2027244 1 1 215 annotation2027246 1 BBa_K174000 range2027246 1 222 719 BBa_K174001 1 BBa_K174001 Arabinose inducible system 2009-09-25T11:00:00Z 2015-05-08T01:10:58Z Wild-type Bacillus subtilis 168 strain. 200 bp long bindingsite_promoter_bindingsite_RBS is amplified by PCR with dangling end primers with EcoRI-NotI-XbaI restriction site at 5??? and SpeI at 3??? and inserted into a Biobrick compatible vector. The sequence is taken from wildtype Bacillus subtilis Comprised of araR binding sites and araE promoter. Regulates the expression of downstream genes with arabinose. false false _277_ 0 3942 9 It's complicated false Forward primer used: GATCTG-GAATTCGCGGCCGCTTCTAGAG-CACAGCGTTCTTTGTAAG (Clamp sequence - Standard Biobrick prefix - first 18 base from the Biobrick) Reverse primer used: TGTGAC-ACTAGTA-GCCCTCCCGAATGTTGAG (Clamp sequence - SpeI site - last 18 base from the Biobrick) false The Newcastle 2009 iGEM team annotation2027218 1 araR binding site range2027218 1 154 178 annotation2027216 1 araR binding site range2027216 1 32 51 annotation2027217 1 sigA promoter range2027217 1 80 123 annotation2027219 1 rbs range2027219 1 208 214 BBa_K174001_sequence 1 cgcgtattttggtaacatatccattcctccaaaatgtatacggacaaatttcagtatatcacagcgttctttgtaagaaaacattgacagaaaatgcaaacaagattattctatatttgtacgtactaattaaatgtaattttcgttaaattttaatataagtacgtacaattgaaggtttaaatgaaaacgctttactcaacattcgggagggc BBa_K174000_sequence 1 atggatttgtcacagctaacaccacgtcgtccctatctgctgcgtgcattctatgagtggttgctggataaccagctcacgccgcacctggtggtggatgtgacgctccctggcgtgcaggttcctatggaatatgcgcgtgacgggcaaatcgtactcaacattgcgccgcgtgctgtcggcaatctggaactggcgaatgatgaggtgcgctttaacgcgcgctttggtggcattccgcgtcaggtttctgtgccgctggctgccgtgctggctatctacgcccgtgaaaatggcgcaggcacgatgtttgagcctgaagctgcctacgatgaagataccagcatcatgaatgatgaagaggcatcggcagacaacgaaaccgttatgtcggttattgatggcgacaagccagatcacgatgatgacactcatcctgacgatgaacctccgcagccaccacgcggtggtcgaccggcattacgcgttgtgaagtaa BBa_K174002_sequence 1 cgcgtattttggtaacatatccattcctccaaaatgtatacggacaaatttcagtatatcacagcgttctttgtaagaaaacattgacagaaaatgcaaacaagattattctatatttgtacgtactaattaaatgtaattttcgttaaattttaatataagtacgtacaattgaaggtttaaatgaaaacgctttactcaacattcgggagggctactagatggatttgtcacagctaacaccacgtcgtccctatctgctgcgtgcattctatgagtggttgctggataaccagctcacgccgcacctggtggtggatgtgacgctccctggcgtgcaggttcctatggaatatgcgcgtgacgggcaaatcgtactcaacattgcgccgcgtgctgtcggcaatctggaactggcgaatgatgaggtgcgctttaacgcgcgctttggtggcattccgcgtcaggtttctgtgccgctggctgccgtgctggctatctacgcccgtgaaaatggcgcaggcacgatgtttgagcctgaagctgcctacgatgaagataccagcatcatgaatgatgaagaggcatcggcagacaacgaaaccgttatgtcggttattgatggcgacaagccagatcacgatgatgacactcatcctgacgatgaacctccgcagccaccacgcggtggtcgaccggcattacgcgttgtgaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z