BBa_K174005 1 BBa_K174005 xylA promoter 2009-10-09T11:00:00Z 2015-05-08T01:10:58Z This part is based on pX integration vector which has xlyA promoter with xlyR operator sites. This promoter can be induced by xylose and it is regulated by LacI. XylR is normally expressed i B. subtilis and represses the promoter. Addition of xylose will derepress XlyR activity on the promoter. Biobrick BBa_K143014 is also xylose inducable promoter. They have slightly different operator sites and -10 sequence is one base different. Hence this promoter may have different promoter strength and regulation by XlyR. It should be noted that glucose may act as an anti-inducer for xlyR triggering catabolite repression. false false _277_ 0 3942 9 Not in stock false The sequence from the beginning of xlyA promoter to the start codon just before SpeI site was used to build the part. false The Newcastle 2009 iGEM team annotation2033097 1 XylR operator range2033097 1 43 52 annotation2033095 1 -10 range2033095 1 28 33 annotation2033096 1 -35 range2033096 1 5 10 annotation2033098 1 XylR Operator range2033098 1 58 67 BBa_K174005_sequence 1 aacattgaaataaacatttattttgtatatgatgagataaagttagtttattggataaacaaactaactcaattaagatagttgatggataaacttgttcacttaaatcaaagggggaaatgacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z