BBa_K174009 1 BBa_K174009 CotC, Bacillus subtilis spore coat protein 2009-10-10T11:00:00Z 2015-05-08T01:10:58Z ''Bacillus subtilis'' CotC is a spore coat protein from ''Bacillus subtilis''. Hence proteins fused with CotC can be localised to the spore coat. false false _277_ 0 3942 9 Not in stock false When fusing proteins with CotC, the final sequence should start with CotC and be followed by the sequence of the protein wnated to be localised ot the spore coat. Gfp can be added to the end of the final sequence. false The Newcastle 2009 iGEM team annotation2033734 1 CotC range2033734 1 1 198 BBa_K174009_sequence 1 atgggttattacaaaaaatacaaagaagagtattatacggtcaaaaaaacgtattataagaagtattacgaatatgataaaaaagattatgactgtgattacgacaaaaaatatgatgactatgataaaaaatattatgatcacgataaaaaagactatgattatgttgtagagtataaaaagcataaaaaacactac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z