BBa_K1742001 1 BBa_K1742001 Entertoxin LTB 2015-09-02T11:00:00Z 2015-12-16T01:50:05Z The LTB protein was designed based on a publication that showed that it can be expressed in Nicotiana Benthamiana plants. Diarrheal diseases caused by Vibrio cholera and enterotoxigenic Escherichia coli (ETEC) are worldwide health problems that might be prevented with vaccines based on edible plants expressing the B subunit from either the cholera toxin (CTB) or the E. coli heat labile toxin (LTB). The E. coli heat-labile enterotoxin (LT) is the major ETEC pathogenic factor. LT subunit B (LTB) is of special interest because its immunogenicity, adjuvant activity and lack of toxicity make it a viable antigen to vaccinate against ETEC diarrhea. false false _2164_ 4206 26673 9 It's complicated false The protein consists of the E. coli enterotoxin beta subunit. It is codon optimized for plants and contains a C-terminus 6X Hys tag in order to detected by anti-Hys antibodies. false Ruben Escriba Piera BBa_K1742001_sequence 1 atggtgaaggtgaagtgctacgttttgttcaccgctttgctctcctctctctgcgcttacggagctccacagtccattacagagctctgctccgagtacaggaacacacaaatctacaccatcaacgataagatcctctcctacaccgagtccatggctggaaagagggagatggttatcattacattcaagagcggagctacattccaggtggaggtgccaggaagccaacatattgattcccagaagaaggctattgagaggatgaaggatacattgaggatcacatacctcaccgagacaaagattgataagttgtgcgtgtggaacaacaagaccccaaactccattgctgctatcagcatggagaactactctgagaaagatgagctacatcatcatcatcatcattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z