BBa_K817002 1 BBa_K817002 PfadBA 2012-09-17T11:00:00Z 2015-05-08T01:13:28Z de novo synthesis Released HQ 2013 Fatty acid sensitive promoter false false _1075_ 0 13572 9 In stock false N/A false Yi-Te Lee, Chieh-Mei Wang annotation2197686 1 PfadBA range2197686 1 1 72 BBa_K1747004 1 BBa_K1747004 Fatty acid inducible promoter - no scar - RBS 2015-08-23T11:00:00Z 2015-09-17T06:25:15Z Sequences were acquired from iGEM This is a fatty acid promoter and an RBS without a scar false false _2169_ 27803 27803 9 Not in stock false This intermediate was created with out a scar between the joined sequences false Harry Bennett component2436927 1 BBa_B0034 component2436925 1 BBa_K817002 annotation2436927 1 BBa_B0034 range2436927 1 73 84 annotation2436925 1 BBa_K817002 range2436925 1 1 72 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K817002_sequence 1 atctggtacgaccagatttgacaatctggtacgaccagatgatactgagcacatcagcaggacgcactgacc BBa_K1747004_sequence 1 atctggtacgaccagatttgacaatctggtacgaccagatgatactgagcacatcagcaggacgcactgaccaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z