BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K1749000 1 BBa_K1749000 Cd sensitive promoter with Phi delta activator, PO promoter, and GFP 2015-09-16T11:00:00Z 2016-01-11T01:35:16Z This composite part contains only other biobrick parts. The Cadmium sensitive promoter is combined with amplifiers from the 2009 Cambridge iGEM team to increase the sensitivity to cadmium. It uses GFP as a reporter. false false _2171_ 4206 4261 9 false None. false Anne Byford component2466656 1 BBa_K174016 component2466673 1 BBa_B0012 component2466670 1 BBa_E0040 component2466666 1 BBa_I746352 component2466661 1 BBa_K174017 component2466668 1 BBa_I746361 component2466671 1 BBa_B0010 annotation2466661 1 BBa_K174017 range2466661 1 35 205 annotation2466673 1 BBa_B0012 range2466673 1 1400 1440 annotation2466666 1 BBa_I746352 range2466666 1 214 477 annotation2466656 1 BBa_K174016 range2466656 1 1 26 annotation2466668 1 BBa_I746361 range2466668 1 486 577 annotation2466671 1 BBa_B0010 range2466671 1 1312 1391 annotation2466670 1 BBa_E0040 range2466670 1 584 1303 BBa_K174017 1 BBa_K174017 CadA promoter with CzrA binding site 2009-10-13T11:00:00Z 2015-07-24T01:17:17Z It is taken from ''B. subtilis'' ''cadA'' promoter. In ''B. subtilis'' CadA system works as an efflux system to take the metals out in the cell. It is normally repressed by CzrA repressor protein. When certain metals get inside the cell, they can bind to CzrA and derepress the promoter expressing CadA. Hence metals are taken out by the efflux system. By taking the promoter of CadA system, we created a generic metal sensor. Hence when it is combined with coding sequences of other genes, it will regulate the expression of these genes upon sensing metals. false false _277_ 4206 3942 9 Not in stock false It was developed mainly to use combinatorial approaches for metal sensing false The Newcastle 2009 iGEM team annotation2040828 1 sigA -35 range2040828 1 18 23 annotation2040829 1 sigA -10 range2040829 1 42 47 annotation2040830 1 CzrA binding site range2040830 1 56 86 annotation2040827 1 cadA promoter range2040827 1 11 144 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_I746361 1 BBa_I746361 PO promoter from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z The source of the DNA is the P2 phage genome. Released HQ 2013 This is the PO promoter taken from the P2 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the PO promoter. false false _116_ 0 2122 9 In stock false no special considerations true Stefan Milde annotation1943784 1 PO range1943784 1 1 92 BBa_I746352 1 BBa_I746352 delta activator from phiR73 phage 2007-09-11T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The delta activator taken from phiR73 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943872 1 phiR73 delta range1943872 1 22 264 annotation1943871 1 B0034 range1943871 1 1 12 annotation1943873 1 phiR73 delta range1943873 1 22 22 annotation1943874 1 silent mutation to remove PstI site range1943874 1 102 102 BBa_K174016 1 BBa_K174016 Promoterless ArsR binding site 2009-10-13T11:00:00Z 2015-07-24T01:17:49Z ''B. subtilis'' This part purely holds the binding site for ArsR protein which can be released when bound to different metals. Hence this part can be combined with any promoter to sense metals that can bind to ArsR protein. When added in front of a promoter with another metal sensor's protein's binding site, it can form an AND gate to sensitively detect specific metals. false false _277_ 4206 3942 9 Not in stock false It was developed mainly to use combinatorial approaches for metal sensing. false The Newcastle 2009 iGEM team annotation2040774 1 ArsR binding site range2040774 1 9 26 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I746361_sequence 1 cgcgccccgcgattcgctaaggtgctgttgtgtcagtgataagccatccgggactgatggcggaggatgcgcatcgtcgggaaactgatgcc BBa_K174017_sequence 1 gcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagc BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K174016_sequence 1 agtaatcaaaataaattgatttattt BBa_I746352_sequence 1 aaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa BBa_K1749000_sequence 1 agtaatcaaaataaattgatttattttactagaggcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagctactagagaaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaatactagagcgcgccccgcgattcgctaaggtgctgttgtgtcagtgataagccatccgggactgatggcggaggatgcgcatcgtcgggaaactgatgcctactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z