BBa_K175000 1 BBa_K175000 trbC (pilin) of IncP beta R751 plasmid 2009-07-04T11:00:00Z 2015-05-08T01:10:58Z This part comes from http://www.ncbi.nlm.nih.gov/nuccore/70907607?from=48797&to=51040&report=gbwithparts and corresponds to range 48797..51040 of the R751 sequence. The relaxase / helicase TraI of the IncP beta plasmid R751. Essential of conjugative transfer. This part nicks oriT. It should be placed on a message plasmid along with oriT, and will enable transfer of the message plasmid in the presence of a modified R751 helper plasmid such as BBa_I714037. false false _280_ 0 4286 9 Not in stock false None false Calin Plesa annotation2008011 1 trbC range2008011 1 1 468 BBa_K175000_sequence 1 atgcaggccactttcccggcgttccgcctgaaccgaaatgcactattttacatgggtctattcgctctgctggccttttttctgctggcacctcaacacgcgtttgcatcggaaggtacaggaggaagcttaccgtacgagtcgtggctgaccaacctccgcaactctgtcaccggaccagttgcgtttgcgctaagcatcatagggattgtagtggccggcggcattctaatttttgggggagagctgaatggttttcttcgcacgcttattttcatcgttcttgttatggggctcctggtcggggcgcagaacatgatgagcactttttttggccggggggcggagatcgccgcgctcacagacggtgccttacatcaggtcaaagtagcagctttggacgtagccggttttcctggcgaagctgtgatgcgctgggcagaacgcgggcatattgcaggctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z