BBa_K175001 1 BBa_K175001 trbK (entry exclusion) of IncP beta R751 plasmid 2009-07-05T11:00:00Z 2015-05-08T01:10:59Z This sequence can be found at http://www.ncbi.nlm.nih.gov/protein/10955220 This part encodes for trbK, a small 75 amino acid cytoplasmic membrane lipoprotein which handles the entry exclusion in the R751 plasmid. Expression of this part in a cell without R751 will significantly reduce the transfer frequency from R751 donors. This is designed to prevent redundant transfers from occurring. Note that the presence of entry exclusion has been linked to the prevention of lethal zygosis. If the entry exclusion (Eex) index is defined as the transfer frequency for receiver cells not containing the trbK protein divided by the transfer frequency for receiver cells containing the trbK protein than for R751 Eex index = 44,000 (See Table 5 of Haase, J., Kalkum, M. & Lanka, E. TrbK, a small cytoplasmic membrane lipoprotein, functions in entry exclusion of the IncP alpha plasmid RP4. J. Bacteriol. 178, 6720???6729 (1996).[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=178567]) false false _280_ 0 4286 9 It's complicated true None false Calin Plesa annotation2009448 1 trbK range2009448 1 1 231 BBa_K175001_sequence 1 atgaaagcgatcaaagcgctgtctctggcgtctgcggcgctggttgcggcgctggttgcgggttgcgacaacaaaccggcgaccgcgccgatgccggaagttaacgacgaatcttgcaaaccggaaaacatcgcgaaaatcgaagacaaaggtgttcagcaggcgttctcttctctgtgcctgcgtcgtggtggtgacttcaaaccgtctccgaaacgtgaatggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z