BBa_K175031 1 LMR Lock for medium RBS (B0032) from the lock/key library TUD09 2009-09-30T11:00:00Z 2015-05-08T01:10:59Z The biobrick was designed using the lock/key library algorithm constructed by TUDelft iGEM 09 team. The algorithm is based on the work of Isaacs F. et al 2004, Berkeley iGEM 2006, Caltech iGEM 2007 and Peking iGEM 2007. This biobrick generates a mRNA which forms a secondary structure blocking the (medium) RBS. false false _280_ 0 4299 9 In stock true Functionality is being tested false Daniel Solis Escalante annotation2027755 1 Medium RBS B0032 range2027755 1 35 47 BBa_K175031_sequence 1 gtactatcctgtgtgaggactttgggtagatcactcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z