BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_K608003 1 BBa_K608003 strong Promoter , medium RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z composite Released HQ 2013 strong Promotor , medium RBS false false _780_ 0 9115 9 In stock false composite false Julia M??ller component2128651 1 BBa_B0032 component2128649 1 BBa_J23104 annotation2128651 1 BBa_B0032 range2128651 1 44 56 annotation2128649 1 BBa_J23104 range2128649 1 1 35 BBa_K1755002 1 BBa_K1755002 ribB+B0015 2015-04-19T11:00:00Z 2015-06-01T08:38:11Z ribB with double terminators false false _2177_ 21246 21246 9 Not in stock false false Haotian Wang component2432413 1 BBa_B0014 component2432406 1 BBa_K1755001 annotation2432406 1 BBa_K1755001 range2432406 1 1 654 annotation2432413 1 BBa_B0014 range2432413 1 663 757 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_K1755001 1 BBa_K1755001 ribB coding sequence 2015-04-19T11:00:00Z 2015-05-08T01:11:00Z You can find it from almost all E.coli cells. More infomation you can find from this website: http://www.ncbi.nlm.nih.gov/gene/12931678 ribB&#65292;the 3,4 dihydroxy-2-butanone-4-phosphate synthase&#12290; We get this part from E.coli genome by PCR. It can increase the electric output by synthesis of riboflavin. false false _2177_ 0 21246 9 Not in stock false The primer is below: F:5'-3' CGT TCTAGA TGAATCAGACGCT 60.46 45 22 R:5'-3' GGT ACTAGT TCAGCTGGCTTAC 60.66 50 22 false Haotian Wang BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1755005 1 BBa_K1755005 strong promoter + medium RBS +ribB + terminator 2015-04-19T11:00:00Z 2015-05-08T01:11:00Z strong promoter + medium RBS +ribB + terminator false false _2177_ 0 21246 9 Not in stock false false Haotian Wang component2431207 1 BBa_K608003 component2431212 1 BBa_B0012 component2431209 1 BBa_B0010 component2431216 1 BBa_K1755002 annotation2431216 1 BBa_K1755002 range2431216 1 63 853 annotation2431207 1 BBa_K608003 range2431207 1 1 56 annotation2431212 1 BBa_B0012 range2431212 1 813 853 annotation2431209 1 BBa_B0010 range2431209 1 725 804 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K608003_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagtcacacaggaaag BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K1755001_sequence 1 atgaatcagacgctactttcctcttttggtacgcctttcgaacgtgttgaaaatgcactggctgcgctgcgtgaaggacgcggtgtaatggtgcttgatgatgaagaccgtgaaaacgaaggtgatatgatcttcccggcagaaaccatgactgttgagcagatggcgctgaccattcgccacggtagcggtattgtttgcctgtgcattactgaagatcgccgtaaacaactcgatctgccaatgatggtagaaaataacaccagcgcctatggcaccggttttaccgtgaccattgaagcagctgaaggtgtgactaccggtgtttctgccgctgaccgtattacgaccgttcgcgcagcgattgccgatggcgcaaaaccgtcagatctgaatcgtcctggccacgttttcccacttcgcgctcaggcaggtggtgtactgacgcgtggcggtcatactgaagcaactattgatctgatgacgctggcaggctttaaaccggctggtgtactgtgtgagctgactaatgacgatggcacgatggcgcgtgcaccagagtgtattgagtttgccaataaacacaatatggcgctcgtgactattgaagacctggtggcataccgtcaggcacatgagcgtaaagccagctga BBa_K1755002_sequence 1 atgaatcagacgctactttcctcttttggtacgcctttcgaacgtgttgaaaatgcactggctgcgctgcgtgaaggacgcggtgtaatggtgcttgatgatgaagaccgtgaaaacgaaggtgatatgatcttcccggcagaaaccatgactgttgagcagatggcgctgaccattcgccacggtagcggtattgtttgcctgtgcattactgaagatcgccgtaaacaactcgatctgccaatgatggtagaaaataacaccagcgcctatggcaccggttttaccgtgaccattgaagcagctgaaggtgtgactaccggtgtttctgccgctgaccgtattacgaccgttcgcgcagcgattgccgatggcgcaaaaccgtcagatctgaatcgtcctggccacgttttcccacttcgcgctcaggcaggtggtgtactgacgcgtggcggtcatactgaagcaactattgatctgatgacgctggcaggctttaaaccggctggtgtactgtgtgagctgactaatgacgatggcacgatggcgcgtgcaccagagtgtattgagtttgccaataaacacaatatggcgctcgtgactattgaagacctggtggcataccgtcaggcacatgagcgtaaagccagctgatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0032_sequence 1 tcacacaggaaag BBa_K1755005_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagtcacacaggaaagtactagatgaatcagacgctactttcctcttttggtacgcctttcgaacgtgttgaaaatgcactggctgcgctgcgtgaaggacgcggtgtaatggtgcttgatgatgaagaccgtgaaaacgaaggtgatatgatcttcccggcagaaaccatgactgttgagcagatggcgctgaccattcgccacggtagcggtattgtttgcctgtgcattactgaagatcgccgtaaacaactcgatctgccaatgatggtagaaaataacaccagcgcctatggcaccggttttaccgtgaccattgaagcagctgaaggtgtgactaccggtgtttctgccgctgaccgtattacgaccgttcgcgcagcgattgccgatggcgcaaaaccgtcagatctgaatcgtcctggccacgttttcccacttcgcgctcaggcaggtggtgtactgacgcgtggcggtcatactgaagcaactattgatctgatgacgctggcaggctttaaaccggctggtgtactgtgtgagctgactaatgacgatggcacgatggcgcgtgcaccagagtgtattgagtttgccaataaacacaatatggcgctcgtgactattgaagacctggtggcataccgtcaggcacatgagcgtaaagccagctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z