BBa_K1755006 1 BBa_K1755006 medium promoter +medium RBS + ribB + terminators 2015-04-19T11:00:00Z 2015-05-08T01:11:00Z medium promoter +medium RBS + ribB + terminators false false _2177_ 0 21246 9 Not in stock false false Haotian Wang component2431226 1 BBa_B0012 component2431223 1 BBa_B0010 component2431221 1 BBa_K608006 component2431230 1 BBa_K1755002 annotation2431226 1 BBa_B0012 range2431226 1 813 853 annotation2431230 1 BBa_K1755002 range2431230 1 63 853 annotation2431223 1 BBa_B0010 range2431223 1 725 804 annotation2431221 1 BBa_K608006 range2431221 1 1 56 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1755001 1 BBa_K1755001 ribB coding sequence 2015-04-19T11:00:00Z 2015-05-08T01:11:00Z You can find it from almost all E.coli cells. More infomation you can find from this website: http://www.ncbi.nlm.nih.gov/gene/12931678 ribB&#65292;the 3,4 dihydroxy-2-butanone-4-phosphate synthase&#12290; We get this part from E.coli genome by PCR. It can increase the electric output by synthesis of riboflavin. false false _2177_ 0 21246 9 Not in stock false The primer is below: F:5'-3' CGT TCTAGA TGAATCAGACGCT 60.46 45 22 R:5'-3' GGT ACTAGT TCAGCTGGCTTAC 60.66 50 22 false Haotian Wang BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K608006 1 BBa_K608006 medium Promoter , medium RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z composite Released HQ 2013 medium Promotor , medium RBS false false _780_ 0 9115 9 In stock false composite false Julia M??ller component2128659 1 BBa_J23110 component2128661 1 BBa_B0032 annotation2128659 1 BBa_J23110 range2128659 1 1 35 annotation2128661 1 BBa_B0032 range2128661 1 44 56 BBa_J23110 1 BBa_J23110 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1755002 1 BBa_K1755002 ribB+B0015 2015-04-19T11:00:00Z 2015-06-01T08:38:11Z ribB with double terminators false false _2177_ 21246 21246 9 Not in stock false false Haotian Wang component2432406 1 BBa_K1755001 component2432413 1 BBa_B0014 annotation2432406 1 BBa_K1755001 range2432406 1 1 654 annotation2432413 1 BBa_B0014 range2432413 1 663 757 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1755006_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgaatcagacgctactttcctcttttggtacgcctttcgaacgtgttgaaaatgcactggctgcgctgcgtgaaggacgcggtgtaatggtgcttgatgatgaagaccgtgaaaacgaaggtgatatgatcttcccggcagaaaccatgactgttgagcagatggcgctgaccattcgccacggtagcggtattgtttgcctgtgcattactgaagatcgccgtaaacaactcgatctgccaatgatggtagaaaataacaccagcgcctatggcaccggttttaccgtgaccattgaagcagctgaaggtgtgactaccggtgtttctgccgctgaccgtattacgaccgttcgcgcagcgattgccgatggcgcaaaaccgtcagatctgaatcgtcctggccacgttttcccacttcgcgctcaggcaggtggtgtactgacgcgtggcggtcatactgaagcaactattgatctgatgacgctggcaggctttaaaccggctggtgtactgtgtgagctgactaatgacgatggcacgatggcgcgtgcaccagagtgtattgagtttgccaataaacacaatatggcgctcgtgactattgaagacctggtggcataccgtcaggcacatgagcgtaaagccagctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K608006_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaag BBa_K1755001_sequence 1 atgaatcagacgctactttcctcttttggtacgcctttcgaacgtgttgaaaatgcactggctgcgctgcgtgaaggacgcggtgtaatggtgcttgatgatgaagaccgtgaaaacgaaggtgatatgatcttcccggcagaaaccatgactgttgagcagatggcgctgaccattcgccacggtagcggtattgtttgcctgtgcattactgaagatcgccgtaaacaactcgatctgccaatgatggtagaaaataacaccagcgcctatggcaccggttttaccgtgaccattgaagcagctgaaggtgtgactaccggtgtttctgccgctgaccgtattacgaccgttcgcgcagcgattgccgatggcgcaaaaccgtcagatctgaatcgtcctggccacgttttcccacttcgcgctcaggcaggtggtgtactgacgcgtggcggtcatactgaagcaactattgatctgatgacgctggcaggctttaaaccggctggtgtactgtgtgagctgactaatgacgatggcacgatggcgcgtgcaccagagtgtattgagtttgccaataaacacaatatggcgctcgtgactattgaagacctggtggcataccgtcaggcacatgagcgtaaagccagctga BBa_K1755002_sequence 1 atgaatcagacgctactttcctcttttggtacgcctttcgaacgtgttgaaaatgcactggctgcgctgcgtgaaggacgcggtgtaatggtgcttgatgatgaagaccgtgaaaacgaaggtgatatgatcttcccggcagaaaccatgactgttgagcagatggcgctgaccattcgccacggtagcggtattgtttgcctgtgcattactgaagatcgccgtaaacaactcgatctgccaatgatggtagaaaataacaccagcgcctatggcaccggttttaccgtgaccattgaagcagctgaaggtgtgactaccggtgtttctgccgctgaccgtattacgaccgttcgcgcagcgattgccgatggcgcaaaaccgtcagatctgaatcgtcctggccacgttttcccacttcgcgctcaggcaggtggtgtactgacgcgtggcggtcatactgaagcaactattgatctgatgacgctggcaggctttaaaccggctggtgtactgtgtgagctgactaatgacgatggcacgatggcgcgtgcaccagagtgtattgagtttgccaataaacacaatatggcgctcgtgactattgaagacctggtggcataccgtcaggcacatgagcgtaaagccagctgatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0032_sequence 1 tcacacaggaaag BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_J23110_sequence 1 tttacggctagctcagtcctaggtacaatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z