BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_K1758106 1 BBa_K1758106 Translation enhancing 5-UTR + mRFP under control of T7 promoter 2015-08-26T11:00:00Z 2015-09-18T06:40:02Z This part was obtained via Gibson primers that bind on [http://parts.igem.org/Part:BBa_K1758105 BBa_K1758105]. mRFP generator ([http://parts.igem.org/Part:BBa_K516030 BBa_K516030]) under control of the T7 promoter ([http://parts.igem.org/Part:BBa_I719005 BBa_I719005]). The part includes a translation enhancing sequence, 5'-UTR, which improves the binding of the mRNA to the ribosome ([http://www.ncbi.nlm.nih.gov/pubmed/2676996 Olins et al. 1989]). The 5'-UTR sequence contains a spacer of 10 adenine bases which has been shown to further enhance translation efficiency ([http://www.ncbi.nlm.nih.gov/pubmed/23927491 Takahashi et al. 2013]). false false _2180_ 26563 26563 9 false See [http://parts.igem.org/Part:BBa_K1758102:Design BBa_K1758102] false Team Bielefeld-CeBiTec 2015 component2439103 1 BBa_I719005 component2439106 1 BBa_K1758100 component2439116 1 BBa_K283035 annotation2439116 1 BBa_K283035 range2439116 1 70 912 annotation2439103 1 BBa_I719005 range2439103 1 1 23 annotation2439106 1 BBa_K1758100 range2439106 1 24 69 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_K283035 1 BBa_K283035 RFP-double terminators 2009-10-15T11:00:00Z 2015-05-08T01:11:48Z From the registry Released HQ 2013 cI coding protein on plasmid backbone J61002 false false _383_ 0 5494 9 In stock false BBa_K283035 false Shi Lei, Nelson Chu component2246776 1 BBa_E1010 component2246777 1 BBa_B0010 component2246779 1 BBa_B0012 annotation2246779 1 BBa_B0012 range2246779 1 803 843 annotation2246776 1 BBa_E1010 range2246776 1 1 706 annotation2246777 1 BBa_B0010 range2246777 1 715 794 BBa_K1758100 1 BBa_K1758100 Translation enhancing 5-UTR containing g10-L RBS 2015-08-20T11:00:00Z 2015-09-19T02:12:15Z This part was created by applying Gibson primers with suitable overhangson pSB1C3. This sequence contains a 5' untranslated region (5'-UTR) and a strong ribosomal binding site from bacteriophage T7, named ''g10''-L. This sequence greatly enhances translation of a following gene. The enhancing effect relies on the regulation of mRNA binding to and release of the ribosome S30 subunit (for details see [http://www.ncbi.nlm.nih.gov/pubmed/2676996 Olins et al. 1989] and [http://www.ncbi.nlm.nih.gov/pubmed/23927491 Takahashi et al. 2013]). ''g10''-L is a strong RBS in ''E. coli'' but also well suited for foreign gene expression ([http://www.nature.com/nbt/journal/v9/n5/abs/nbt0591-477.html Rangwala et al. 1991]) false false _2180_ 26563 26563 9 false We derived this sequence from the literature, searching for the best suited enhancing sequence for ''in vitro'' translation. Our main literature sources were [http://www.ncbi.nlm.nih.gov/pubmed/2676996 Olins et al. 1989], [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3161345/ Shin and Noireaux 2010], [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3128707/ Zawada et al. 2011] and [http://www.ncbi.nlm.nih.gov/pubmed/23927491 Takahashi et al. 2013]. false Team Bielefeld-CeBiTec 2015 annotation2436604 1 g10-L RBS range2436604 1 32 39 annotation2436605 1 10 A spacer range2436605 1 22 31 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_K1758106_sequence 1 taatacgactcactatagggagaaataattttgtttaactttaaaaaaaaaaaagaaggagaataatctatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1758100_sequence 1 aataattttgtttaactttaaaaaaaaaaaagaaggagaataatct BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K283035_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z