BBa_K176000 1 pLux/Tet pLux/Tet Hybrid Promoter: (LuxR+,TetR-)->PoPS 2009-05-05T11:00:00Z 2015-05-08T01:11:00Z Tet Operator sequence from BBa_R0040 sense TWO INPUTS, activation by AHL and repression by tetR false false _282_ 0 4010 9 It's complicated true How to arrange the two parts together? false Danqian Liu, Chao Li, Hao Jiang annotation2002611 1 +1 range2002611 1 53 53 annotation2002612 1 luxR/HSL range2002612 1 1 20 annotation2002609 1 -10 range2002609 1 42 47 annotation2002607 1 R0062 range2002607 1 1 53 annotation2002608 1 -35 range2002608 1 20 25 annotation2002610 1 tetR range2002610 1 54 72 BBa_K176000_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatatccctatcagtgatagaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z