BBa_K176008 1 pCon 0.15 constitutive promoter family member J23115 actual sequence (pCon 0.15) 2009-06-16T11:00:00Z 2015-05-08T01:11:01Z J23115 Released HQ 2013 The sequence of J23115 is wrong according to sequencing result of the registry and ours. This part K176008 is created for the actual promoter. http://partsregistry.org/cgi/sequencing/one_blast.cgi?id=3647 http://partsregistry.org/cgi/sequencing/one_blast.cgi?id=1209 J23115: tttatagctagctcagCcctTggtacaatgctagc K176008: tttatagctagctcagTcctAggtacaatgctagc false true _282_ 0 3908 9 In stock true This is the actual sequence of J23115. false Hao Jiang, Danqian Liu, Chao Li annotation2005565 1 AvrII range2005565 1 18 23 annotation2005559 1 -35 range2005559 1 1 6 annotation2005564 1 NheI range2005564 1 30 35 annotation2005561 1 c in J23115 range2005561 1 17 17 annotation2005562 1 t in J23115 range2005562 1 21 21 annotation2005563 1 NheI range2005563 1 7 12 annotation2005560 1 -10 range2005560 1 24 29 BBa_K176008_sequence 1 tttatagctagctcagtcctaggtacaatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z