BBa_K176009 1 pCon 0.36 constitutive promoter family member J23107 actual sequence (pCon 0.36) 2009-06-19T11:00:00Z 2015-05-08T01:11:01Z This is the actual sequence of J23107. Released HQ 2013 The sequence of J23107 is wrong according to sequencing result of the registry and ours. This part K176009 is created for the actual promoter. http://partsregistry.org/cgi/sequencing/one_blast.cgi?id=3628 http://partsregistry.org/cgi/sequencing/one_blast.cgi?id=1184 J23107: tttacggctagctcagCcctaggtattatgctagc K176009: tttacggctagctcagTcctaggtattatgctagc false false _282_ 0 3908 9 In stock true J23107 false Hao Jiang, Danqian Liu, Chao Li annotation2005860 1 NheI range2005860 1 30 35 annotation2005855 1 -35 range2005855 1 1 6 annotation2005858 1 AvrII range2005858 1 18 23 annotation2005856 1 NheI range2005856 1 7 12 annotation2005859 1 -10 range2005859 1 24 29 annotation2005857 1 c in J23107 range2005857 1 17 17 BBa_K176009_sequence 1 tttacggctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z