BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K176027 1 lacZalpha- PoPS->RBS+lacZalpha-ccdB->PoPS 2009-07-17T11:00:00Z 2015-05-08T01:11:02Z B0034 K176003 RBS+lacZalpha-ccdB false false _282_ 0 3908 9 It's complicated true strong RBS + lacZalpha-ccdB coding false Zongxiao He, Hao Jiang component2011627 1 BBa_B0034 component2011639 1 BBa_K176003 annotation2011639 1 BBa_K176003 range2011639 1 19 498 annotation2011627 1 BBa_B0034 range2011627 1 1 12 BBa_K176003 1 lacZa-ccdB lacZalpha-ccdB coding sequence 2009-07-02T11:00:00Z 2015-07-09T11:37:13Z PCR from the plasmid pluxCcdB3(a gift from Prof. Lingchong You). Forward Primer: GTTTCT TCTAG ATG accatgattacgg attcactggccgtcgttttac Reverse Primer: GTTTCTTC CTGCAG CGGCCGC T ACTAGT A TTATTA tattccccagaacatcaggtta Digest with XbaI and SpeI, ligate into pSB1A3. A fusion protein of lacZalpha(I732006) and ccdB(K145151). It should have the function of ccdB to cause E. coli cells to die, but have less toxicity because of the lacZalpha part. It should also have the function of lacZalpha as a reporter for measurement. This part is similar to J32026 but the multiple cloning sites are eliminated. It is constructed by PCR from the plasmid pluxCcdB3(a gift from Prof. Lingchong You). true false _282_ 4206 3908 9 It's complicated true The part is similar to BBa_J32026 and the original coding sequence in pluxCcdB3, but the multiple cloning sites are eliminated in order to avoid site-specific mutagenesis. The multiple cloning sites are from lacZalpha in pZErO-2. After eliminate the MCS, the lacZalpha part is identical to the N-terminal of the wild type gene(BBa_I732006 & BBa_I732005), and fused with the ccdB part (BBa_K145151) with a 3aa linker. false Zongxiao He, Hao Jiang annotation2008009 1 c in K145151 range2008009 1 255 255 annotation2008003 1 M13 -20 primer range2008003 1 21 37 annotation2008005 1 M13 -40 primer range2008005 1 41 57 annotation2020665 1 lacZalpha-ccdB range2020665 1 1 474 annotation2008006 1 g and 69bp in I732006 range2008006 1 165 165 annotation2008001 1 Start range2008001 1 1 3 annotation2008002 1 177bp and a in J32026 range2008002 1 16 16 annotation2008004 1 M13 -47 primer (K176059) range2008004 1 41 64 annotation2008010 1 Stop range2008010 1 475 480 annotation2008007 1 at in K145151 range2008007 1 172 173 annotation2008008 1 ccdB (K145151) range2008008 1 172 477 annotation2011971 1 VRccdB primer (K176058) range2011971 1 188 215 annotation2008000 1 a part of lacZalpha (I732006) range2008000 1 1 165 BBa_K176003_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctatacgtacggcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K176027_sequence 1 aaagaggagaaatactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctatacgtacggcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z