BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_K176034 1 BBa_K176034 PoPS->RBS+lacZalpha-ccdB+T 2009-07-19T11:00:00Z 2015-05-08T01:11:02Z K176027 B0015 Generate lacZalpha-ccdB false false _282_ 0 3908 9 It's complicated false strong RBS + lacZalpha-ccdB coding + strong terminator false Zongxiao He, Hao Jiang component2011847 1 BBa_B0034 component2011862 1 BBa_B0012 component2011859 1 BBa_K176003 component2011860 1 BBa_B0010 annotation2011847 1 BBa_B0034 range2011847 1 1 12 annotation2011860 1 BBa_B0010 range2011860 1 507 586 annotation2011859 1 BBa_K176003 range2011859 1 19 498 annotation2011862 1 BBa_B0012 range2011862 1 595 635 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K176003 1 lacZa-ccdB lacZalpha-ccdB coding sequence 2009-07-02T11:00:00Z 2015-07-09T11:37:13Z PCR from the plasmid pluxCcdB3(a gift from Prof. Lingchong You). Forward Primer: GTTTCT TCTAG ATG accatgattacgg attcactggccgtcgttttac Reverse Primer: GTTTCTTC CTGCAG CGGCCGC T ACTAGT A TTATTA tattccccagaacatcaggtta Digest with XbaI and SpeI, ligate into pSB1A3. A fusion protein of lacZalpha(I732006) and ccdB(K145151). It should have the function of ccdB to cause E. coli cells to die, but have less toxicity because of the lacZalpha part. It should also have the function of lacZalpha as a reporter for measurement. This part is similar to J32026 but the multiple cloning sites are eliminated. It is constructed by PCR from the plasmid pluxCcdB3(a gift from Prof. Lingchong You). true false _282_ 4206 3908 9 It's complicated true The part is similar to BBa_J32026 and the original coding sequence in pluxCcdB3, but the multiple cloning sites are eliminated in order to avoid site-specific mutagenesis. The multiple cloning sites are from lacZalpha in pZErO-2. After eliminate the MCS, the lacZalpha part is identical to the N-terminal of the wild type gene(BBa_I732006 & BBa_I732005), and fused with the ccdB part (BBa_K145151) with a 3aa linker. false Zongxiao He, Hao Jiang annotation2011971 1 VRccdB primer (K176058) range2011971 1 188 215 annotation2008000 1 a part of lacZalpha (I732006) range2008000 1 1 165 annotation2008003 1 M13 -20 primer range2008003 1 21 37 annotation2008005 1 M13 -40 primer range2008005 1 41 57 annotation2008010 1 Stop range2008010 1 475 480 annotation2008007 1 at in K145151 range2008007 1 172 173 annotation2008002 1 177bp and a in J32026 range2008002 1 16 16 annotation2020665 1 lacZalpha-ccdB range2020665 1 1 474 annotation2008001 1 Start range2008001 1 1 3 annotation2008004 1 M13 -47 primer (K176059) range2008004 1 41 64 annotation2008008 1 ccdB (K145151) range2008008 1 172 477 annotation2008009 1 c in K145151 range2008009 1 255 255 annotation2008006 1 g and 69bp in I732006 range2008006 1 165 165 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K176034_sequence 1 aaagaggagaaatactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctatacgtacggcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K176003_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctatacgtacggcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z