BBa_K176037 1 VR3 bindin Reverse primer VR3 (K176047) binding site 2009-08-12T11:00:00Z 2015-05-08T01:11:02Z Reverse complement of VR3 (K176047). Picked from random sequences. This part can be ligated into composite parts as a primer binding site for PCR identification of the part or sequencing of the part. It will be very useful when many composite parts have similar lengths, then PCR using VF2 and VR cannot be used to identify the parts. Reverse primers VR3~VR12 are designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. These primers are designed to be perfectly paired with VF2 and without cross-reactivities to each other. false false _282_ 0 3908 9 It's complicated true Designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. Main parameters for picking VR3~VR12: Size: 20 bp (N19 + G or C) Tm: VF2 Tm ??1℃ GC%: 50% Max Self Complementarity: 3 bp Max 3' Self Complementarity: 2 bp Max Pair Complementarity: 3 bp Max 3' Pair Complementarity: 2 bp Max 3' Stability: 3.36 kcal/mol Max Template(pSB1A3) Mispriming: 6 bp Max Mispriming With Other VR3~VR12 Sites: 4 bp false Jiayi Dou, Hao Jiang annotation2017241 1 VF3 range2017241 1 1 20 BBa_K176037_sequence 1 caatacaactttcggcggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z