BBa_K176056 1 VR12 Reverse primer VR12 (bind to K176046), member of VR3~VR12 2009-08-12T11:00:00Z 2015-05-08T01:11:02Z Reverse complement of K176046. Picked from random sequences. This part binds to K176046, which can be ligated into composite parts as a primer binding site for PCR identification of the part or sequencing of the part. It will be very useful when many composite parts have similar lengths, then PCR using VF2 and VR cannot be used to identify the parts. Reverse primers VR3~VR12 are designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. These primers are designed to be perfectly paired with VF2 and without cross-reactivities to each other. false false _282_ 0 3908 9 Not in stock true Designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. false Jiayi Dou, Hao Jiang BBa_K176056_sequence 1 atgtgcggattgtccacttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z