BBa_K176057 1 VFtetR Forward sequencing primer binds to tetR 3prime terminal (VFtetR) 2009-07-19T11:00:00Z 2015-05-08T01:11:02Z 3' terminal of C0040(tetR-LVA) and I732080(tetR) Used as a internal primer in sequencing long composite BioBrick parts containing tetR. false false _282_ 0 3908 9 Not in stock true Designed with Primer3: http://frodo.wi.mit.edu/ false Hao Jiang BBa_K176057_sequence 1 tgcggattagaaaaacaacttaaatgtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z