BBa_K176058 1 VRccdB Reverse sequencing primer binds to ccdB 5prime terminal (VRccdB) 2009-07-20T11:00:00Z 2015-05-08T01:11:02Z Complement to 5' terminal of K145151(ccdB) and K176003(lacZalpha-ccdB) Used as a internal primer in sequencing long composite BioBrick parts containing ccdB. false false _282_ 0 3908 9 Not in stock true Designed with Primer3: http://frodo.wi.mit.edu/ false Hao Jiang BBa_K176058_sequence 1 cgataacggctctctcttttataggtgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z