BBa_K176059 1 M13 -47 M13 -47 general primer as a reverse primer binds to 5prime terminal of lacZ 2009-07-20T11:00:00Z 2015-05-08T01:11:02Z Complement to 5' terminal of I732017(lacZ), I732018(lacZalpha) and K176003(lacZalpha-ccdB). Used as a internal primer in sequencing long composite BioBrick parts containing lacZ or lacZalpha. false false _282_ 0 3908 9 Not in stock true Designed with Primer3: http://frodo.wi.mit.edu/ false Hao Jiang BBa_K176059_sequence 1 cgccagggttttcccagtcacgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z