BBa_K176061 1 BBa_K176061 PoPS->RBS(weak)+lacZalpha-ccdB->PoPS 2009-08-06T11:00:00Z 2015-05-08T01:11:02Z B0031 K176003 RBS(weak)+lacZalpha-ccdB false false _282_ 0 3908 9 It's complicated false weak RBS + lacZalpha-ccdB coding false Zongxiao He, Hao Jiang component2015424 1 BBa_K176003 component2015411 1 BBa_B0031 annotation2015411 1 BBa_B0031 range2015411 1 1 14 annotation2015424 1 BBa_K176003 range2015424 1 21 500 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_K176003 1 lacZa-ccdB lacZalpha-ccdB coding sequence 2009-07-02T11:00:00Z 2015-07-09T11:37:13Z PCR from the plasmid pluxCcdB3(a gift from Prof. Lingchong You). Forward Primer: GTTTCT TCTAG ATG accatgattacgg attcactggccgtcgttttac Reverse Primer: GTTTCTTC CTGCAG CGGCCGC T ACTAGT A TTATTA tattccccagaacatcaggtta Digest with XbaI and SpeI, ligate into pSB1A3. A fusion protein of lacZalpha(I732006) and ccdB(K145151). It should have the function of ccdB to cause E. coli cells to die, but have less toxicity because of the lacZalpha part. It should also have the function of lacZalpha as a reporter for measurement. This part is similar to J32026 but the multiple cloning sites are eliminated. It is constructed by PCR from the plasmid pluxCcdB3(a gift from Prof. Lingchong You). true false _282_ 4206 3908 9 It's complicated true The part is similar to BBa_J32026 and the original coding sequence in pluxCcdB3, but the multiple cloning sites are eliminated in order to avoid site-specific mutagenesis. The multiple cloning sites are from lacZalpha in pZErO-2. After eliminate the MCS, the lacZalpha part is identical to the N-terminal of the wild type gene(BBa_I732006 & BBa_I732005), and fused with the ccdB part (BBa_K145151) with a 3aa linker. false Zongxiao He, Hao Jiang annotation2008006 1 g and 69bp in I732006 range2008006 1 165 165 annotation2008001 1 Start range2008001 1 1 3 annotation2008003 1 M13 -20 primer range2008003 1 21 37 annotation2008007 1 at in K145151 range2008007 1 172 173 annotation2011971 1 VRccdB primer (K176058) range2011971 1 188 215 annotation2008008 1 ccdB (K145151) range2008008 1 172 477 annotation2008009 1 c in K145151 range2008009 1 255 255 annotation2008000 1 a part of lacZalpha (I732006) range2008000 1 1 165 annotation2008005 1 M13 -40 primer range2008005 1 41 57 annotation2008002 1 177bp and a in J32026 range2008002 1 16 16 annotation2020665 1 lacZalpha-ccdB range2020665 1 1 474 annotation2008004 1 M13 -47 primer (K176059) range2008004 1 41 64 annotation2008010 1 Stop range2008010 1 475 480 BBa_K176003_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctatacgtacggcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa BBa_K176061_sequence 1 tcacacaggaaacctactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctatacgtacggcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa BBa_B0031_sequence 1 tcacacaggaaacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z