BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K176099 1 BBa_K176099 constitutive promoter family member J23119 (pCon max) with primer VR10 site 2009-09-05T11:00:00Z 2015-05-08T01:11:03Z K176044 J23119 VR10 binding site + pCon max false false _282_ 0 3908 9 It's complicated true VR10 binding site + pCon max false Jiayi Dou, Hao Jiang component2018774 1 BBa_J23119 component2018773 1 BBa_K176044 annotation2018773 1 BBa_K176044 range2018773 1 1 20 annotation2018774 1 BBa_J23119 range2018774 1 29 63 BBa_K176044 1 VR10 bindi Reverse primer VR10 (K176054) binding site 2009-08-12T11:00:00Z 2015-05-08T01:11:02Z Reverse complement of VR10 (K176054). Picked from random sequences. This part can be ligated into composite parts as a primer binding site for PCR identification of the part or sequencing of the part. It will be very useful when many composite parts have similar lengths, then PCR using VF2 and VR cannot be used to identify the parts. Reverse primers VR3~VR12 are designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. These primers are designed to be perfectly paired with VF2 and without cross-reactivities to each other. false false _282_ 0 3908 9 It's complicated true Designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. false Jiayi Dou, Hao Jiang annotation2017250 1 VR10 range2017250 1 1 20 BBa_K176044_sequence 1 ctcttcacaatgcgggacat BBa_K176099_sequence 1 ctcttcacaatgcgggacattactagagttgacagctagctcagtcctaggtataatgctagc BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z