BBa_K176037 1 VR3 bindin Reverse primer VR3 (K176047) binding site 2009-08-12T11:00:00Z 2015-05-08T01:11:02Z Reverse complement of VR3 (K176047). Picked from random sequences. This part can be ligated into composite parts as a primer binding site for PCR identification of the part or sequencing of the part. It will be very useful when many composite parts have similar lengths, then PCR using VF2 and VR cannot be used to identify the parts. Reverse primers VR3~VR12 are designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. These primers are designed to be perfectly paired with VF2 and without cross-reactivities to each other. false false _282_ 0 3908 9 It's complicated true Designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. Main parameters for picking VR3~VR12: Size: 20 bp (N19 + G or C) Tm: VF2 Tm ??1℃ GC%: 50% Max Self Complementarity: 3 bp Max 3' Self Complementarity: 2 bp Max Pair Complementarity: 3 bp Max 3' Pair Complementarity: 2 bp Max 3' Stability: 3.36 kcal/mol Max Template(pSB1A3) Mispriming: 6 bp Max Mispriming With Other VR3~VR12 Sites: 4 bp false Jiayi Dou, Hao Jiang annotation2017241 1 VF3 range2017241 1 1 20 BBa_K176100 1 BBa_K176100 constitutive promoter family member J23100 (pCon 1.00) with primer VR3 site 2009-09-05T11:00:00Z 2015-05-08T01:11:03Z K176037 J23100 VR3 binding site + pCon 1.00 false false _282_ 0 3908 9 It's complicated true VR3 binding site + pCon 1.00 false Jiayi Dou, Hao Jiang component2018777 1 BBa_J23100 component2018776 1 BBa_K176037 annotation2018776 1 BBa_K176037 range2018776 1 1 20 annotation2018777 1 BBa_J23100 range2018777 1 29 63 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K176100_sequence 1 caatacaactttcggcggcatactagagttgacggctagctcagtcctaggtacagtgctagc BBa_K176037_sequence 1 caatacaactttcggcggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z