BBa_K1761000 1 BBa_K1761000 Outer Membrane Protein X (OmpX) 2015-09-02T11:00:00Z 2015-09-18T05:39:10Z An outer membrane protein naturally occuring in wildtype E.coli. OmpX is an outer membrane protein with the C- and N-termini in the intracellulair domain. To be able to use OmpX as a scaffold, a non-natural amino acid needs to be introduced. This can be done by implementing the amber stop codon TAG in one of the loops of OmpX via a mutation. With a specific tRNA an azide-functionalized amino acid can be built in, which can be used for the SPAAC click chemistry reaction with DBCO functionalized groups. false false _2183_ 25572 25572 9 false Codon optimalization and deleting restriction sites used for biobricking and classical cloning. false Laura van Smeden annotation2443069 1 OmpX range2443069 1 1 513 BBa_K1761000_sequence 1 atgaaaaaaattgcatgtctttcagcactggccgcagttctggctttcaccgcaggtacttccgtagctgcgacttctactgtaactggcggttacgcacagagcgacgctcagggccaaatgaacaaaatgggcggtttcaacctgaaataccgctatgaagaagacaacagcccgctgggtgtgatcggttctttcacttacaccgagaaaagccgtactgcaagctctggtgactacaacaaaaaccagtactacggcatcactgctggtccggcttaccgcattaacgactgggcaagcatctacggtgtagtgggtgtgggttatggtaaattccagaccactgaatacccgacctacaaacacgacaccagcgactacggtttctcctacggtgcgggtttgcaattcaacccgatggaaaacgttgctctggacttctcttacgagcagagccgtattcgtagcgttgacgtaggcacctggattgccggtgttggttaccgcttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z