BBa_K1761002 1 BBa_K1761002 Outer Membrane Protein X (OmpX) with BsoBI-linker and NanoLuc 2015-09-02T11:00:00Z 2015-09-18T05:40:03Z OmpX is a outer membrane protein naturally occuring in wildtype E.coli. The BsoBI linker is inspired by the article "Quantitative Understanding of the Energy Transfer between Fluorescent Proteins Connected via Flexible Peptide Liners" by Toon H. Evers et all from 29 August 2006. NanoLuc naturally occurs in the organism Oplophorus gracilirostris and was optimalized by the company Promega. OmpX is an outer membrane protein with the C- and N-termini in the intracellulair domain. To be able to use OmpX as a scaffold, a non-natural amino acid needs to be introduced. This can be done by implementing the amber stop codon TAG in one of the loops of OmpX via a mutation. With a specific tRNA an azide-functionalized amino acid can be built in, which can be used for the SPAAC click chemistry reaction with DBCO functionalized groups. The BsoBI linker is a 213 bp long flexible GGSGGS linker. Using the restriction enzyme BsoBI, the linker can become 45 bp shorter. NanoLuc is a small sized and bright luciferase. Under the addition of furimazine, the NanoLuc luciferase generates a bioluminescece emmission spectrum with a maximum around 460 nm. false false _2183_ 25572 25572 9 false The sequence is redesigned considering codon optimalization. Also restriction sites for biobricking and classical cloning are deleted. From the BsoBI linker, the coding sequecne for GGSGGS is redesigned causing that only two BsoBI restriction sites remain. false Laura van Smeden annotation2443223 1 BsoBI linker range2443223 1 514 726 annotation2443222 1 BBa_K1761000 range2443222 1 1 513 annotation2443224 1 NanoLuc range2443224 1 727 1239 BBa_K1761002_sequence 1 atgaaaaaaattgcatgtctttcagcactggccgcagttcttgctttcaccgcaggtacttccgtagcagcgacttctactgtaactggcggttacgcacagagcgacgctcagggccaaatgaacaaaatgggcggtttcaacctgaaataccgctatgaagaagacaacagcccgctgggtgtgatcggttctttcacttacaccgagaaaagccgtactgcaagctctggtgactacaacaaaaaccagtactacggcatcactgctggtccggcttaccgcattaacgactgggcaagcatctacggtgtagtgggtgtgggttatggtaaattccagaccactgaatacccgacctacaaacacgacaccagcgactacggtttctcctacggtgcgggtttgcaattcaacccgatggaaaacgttgctctggacttctcttatgagcagagccgtattcgtagcgttgacgtaggtacgtggattgctggtgttggttatcgcttcactctcggcatggatgagctgtacaaaagcggcattcgtggcggctcgggtggaagcggtgggagtggtggaagcggtgggagtggcggctcgggtgggtcgggcggatcggggggttctggtggcagtggcggctcaggcggctccggtggatcaggtggttcgggtggttctgggggaagcggcgggtcaggtggctctactatggttagcgtatttactcttgaagattttgtcggtgattggcgccagaccgccggctataacctggaccaagtgcttgaacagggcggggttagcagcctgtttcaaaacctgggggtgagtgtcacgccaattcagcgcatcgttctgtcgggagagaatggtctgaaaatcgatatccacgtcattatcccgtacgaaggtctttctggtgatcagatggggcagatagaaaaaatattcaaagtggtgtacccagtagacgatcatcacttcaaggttatactgcactatggcaccctcgttatcgatggcgttactccgaatatgatcgattactttgggcgtccttatgaaggtattgcggtgttcgacggtaaaaaaattacggttaccgggacgctctggaatggtaataaaatcattgatgagcgcttgataaacccagatggcagccttctgttcagagttacgataaacggggttacgggttggcgactgtgcgaaagaatattagcttaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z