BBa_K176101 1 BBa_K176101 constitutive promoter family member J23101 (pCon 0.70) with primer VR4 site 2009-09-05T11:00:00Z 2015-05-08T01:11:03Z K176038 J23101 VR4 binding site + pCon 0.70 false false _282_ 0 3908 9 It's complicated true VR4 binding site + pCon 0.70 false Jiayi Dou, Hao Jiang component2018779 1 BBa_K176038 component2018780 1 BBa_J23101 annotation2018780 1 BBa_J23101 range2018780 1 29 63 annotation2018779 1 BBa_K176038 range2018779 1 1 20 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K176038 1 VR4 bindin Reverse primer VR4 (K176048) binding site 2009-08-12T11:00:00Z 2015-05-08T01:11:02Z Reverse complement of VR4 (K176048). Picked from random sequences. This part can be ligated into composite parts as a primer binding site for PCR identification of the part or sequencing of the part. It will be very useful when many composite parts have similar lengths, then PCR using VF2 and VR cannot be used to identify the parts. Reverse primers VR3~VR12 are designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. These primers are designed to be perfectly paired with VF2 and without cross-reactivities to each other. false false _282_ 0 3908 9 It's complicated true Designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. Main parameters for picking VR3~VR12: Size: 20 bp (N19 + G or C) Tm: VF2 Tm ??1℃ GC%: 50% Max Self Complementarity: 3 bp Max 3' Self Complementarity: 2 bp Max Pair Complementarity: 3 bp Max 3' Pair Complementarity: 2 bp Max 3' Stability: 3.36 kcal/mol Max Template(pSB1A3) Mispriming: 6 bp Max Mispriming With Other VR3~VR12 Sites: 4 bp false Jiayi Dou, Hao Jiang annotation2017242 1 VR4 range2017242 1 1 20 BBa_K176101_sequence 1 ggtttggtgcgtgttgttagtactagagtttacagctagctcagtcctaggtattatgctagc BBa_K176038_sequence 1 ggtttggtgcgtgttgttag BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z