BBa_K176102 1 BBa_K176102 constitutive promoter family member K176009 (pCon 0.36) with primer VR7 site 2009-09-05T11:00:00Z 2015-05-08T01:11:03Z K176041 K176009 VR7 binding site + pCon 0.36 false false _282_ 0 3908 9 It's complicated true VR7 binding site + pCon 0.36 false Jiayi Dou, Hao Jiang component2018782 1 BBa_K176041 component2018789 1 BBa_K176009 annotation2018789 1 BBa_K176009 range2018789 1 29 63 annotation2018782 1 BBa_K176041 range2018782 1 1 20 BBa_K176041 1 VR7 bindin Reverse primer VR7 (K176051) binding site 2009-08-12T11:00:00Z 2015-05-08T01:11:02Z Reverse complement of VR7 (K176051). Picked from random sequences. This part can be ligated into composite parts as a primer binding site for PCR identification of the part or sequencing of the part. It will be very useful when many composite parts have similar lengths, then PCR using VF2 and VR cannot be used to identify the parts. Reverse primers VR3~VR12 are designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. These primers are designed to be perfectly paired with VF2 and without cross-reactivities to each other. false false _282_ 0 3908 9 It's complicated true Designed with our software tool, which is modified from primer3 to pick primers from random sequences for synthetic biological primer design. Main parameters for picking VR3~VR12: Size: 20 bp (N19 + G or C) Tm: VF2 Tm ??1℃ GC%: 50% Max Self Complementarity: 3 bp Max 3' Self Complementarity: 2 bp Max Pair Complementarity: 3 bp Max 3' Pair Complementarity: 2 bp Max 3' Stability: 3.36 kcal/mol Max Template(pSB1A3) Mispriming: 6 bp Max Mispriming With Other VR3~VR12 Sites: 4 bp false Jiayi Dou, Hao Jiang annotation2017245 1 VR7 range2017245 1 1 20 BBa_K176009 1 pCon 0.36 constitutive promoter family member J23107 actual sequence (pCon 0.36) 2009-06-19T11:00:00Z 2015-05-08T01:11:01Z This is the actual sequence of J23107. Released HQ 2013 The sequence of J23107 is wrong according to sequencing result of the registry and ours. This part K176009 is created for the actual promoter. http://partsregistry.org/cgi/sequencing/one_blast.cgi?id=3628 http://partsregistry.org/cgi/sequencing/one_blast.cgi?id=1184 J23107: tttacggctagctcagCcctaggtattatgctagc K176009: tttacggctagctcagTcctaggtattatgctagc false false _282_ 0 3908 9 In stock true J23107 false Hao Jiang, Danqian Liu, Chao Li annotation2005855 1 -35 range2005855 1 1 6 annotation2005859 1 -10 range2005859 1 24 29 annotation2005860 1 NheI range2005860 1 30 35 annotation2005857 1 c in J23107 range2005857 1 17 17 annotation2005858 1 AvrII range2005858 1 18 23 annotation2005856 1 NheI range2005856 1 7 12 BBa_K176009_sequence 1 tttacggctagctcagtcctaggtattatgctagc BBa_K176102_sequence 1 ggtaggtcacagggcaattttactagagtttacggctagctcagtcctaggtattatgctagc BBa_K176041_sequence 1 ggtaggtcacagggcaattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z